Part:BBa_K2656200:Design
pBIOBRICKATOR
- 10INCOMPATIBLE WITH RFC[10]Illegal prefix found at 5
Plasmid lacks a suffix.
Illegal SpeI site found at 921
Illegal PstI site found at 935 - 12INCOMPATIBLE WITH RFC[12]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 5
Illegal NheI site found at 44
Illegal NheI site found at 67
Illegal SpeI site found at 921
Illegal PstI site found at 935
Illegal NotI site found at 11
Illegal NotI site found at 928 - 21INCOMPATIBLE WITH RFC[21]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 5
Illegal XhoI site found at 1952
Illegal XhoI site found at 2844 - 23INCOMPATIBLE WITH RFC[23]Illegal prefix found at 5
Illegal suffix found at 921 - 25INCOMPATIBLE WITH RFC[25]Illegal prefix found at 5
Plasmid lacks a suffix.
Illegal XbaI site found at 20
Illegal SpeI site found at 921
Illegal PstI site found at 935
Illegal AgeI site found at 653
Illegal AgeI site found at 765 - 1000INCOMPATIBLE WITH RFC[1000]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Design Notes
pBioBrickator plasmid was constructed by using a Gibson assembly of the RFP gene and pUD2 backbone. BsmBI recognition sites and GB 3.0 BsmBI alpha 1 overhangs (5’-ggagtgagacg-3’ and 5’-cgtctcagtca-3’) where inserted into this new plasmid by adding them between the template complementary sequence and the homologous overlapping end of each primer. Thus, we have used this primers: ctggaattcgcggccgcttctagagggagtgagacgtttacggctagctc and tttctgcgtttatacgtctcagtcaactagtagcggccgctgcagtc to amplificate the pBioBrickator backbone; and ggccgcttctagagggagtgagacgtttacggctagctcagtcctaggta and ggtgggcctttctgcgtttatacgtctcagtcaactagtagcggccg to amplificate the red transcriptional unit that acts like screening marker.
Source
The original sequence has been obtained from the Registry of Standard Biological Parts. It has been modified using the Gibson assembly method.